katejosiah01 katejosiah01
  • 21-08-2022
  • Mathematics
contestada

how do you write the sum of one-sixth of n and one-fifth of g

Relax

Respuesta :

Medunno13
Medunno13 Medunno13
  • 21-08-2022

Answer: [tex]\frac{n}{6}+\frac{g}{5}[/tex]

Step-by-step explanation:

One-sixth of n is n/6.

One-fifth of g is g/5.

The sum means to add, so the expression is [tex]\frac{n}{6}+\frac{g}{5}[/tex].

Answer Link

Otras preguntas

Which non metal is highly reactive
i feel like no one knows this song but- does anyone know wagon wheel by Darius Rucker
What is the slope of the line?
What length of mirror drive in a Michelson interferometer is required to produce a resolution sufficient to separate
Sophia has asked her mom to pick her up at soccer practice. However, her mom doesn’t show up until half an hour after practice is over. Sophia is angry. Write a
True or False: Pain may affect a person's mobility, digestion, and sleep.
if anyone know the wander please help I need the wander asap
please help me, and be nice, don't be a jer.k (you know who you are..) ty :)
3.Original DNA sequence: 3' TACCGCTTACGTCTGATCGCT 5' Mutated DNA sequence: 3' TACCGCTTATTATTACGTGCTGCTATCGCT 5' Type of mutation (3pts): Amino acid ( 3pts):
What is the domain of the function y=2 square root x-5.