tyriekdash tyriekdash
  • 25-10-2016
  • Mathematics
contestada

Emily has 120 books if it gets tripled how many book do he own now

Relax

Respuesta :

Galactia
Galactia Galactia
  • 25-10-2016
120*3=360. That's the answer.
Answer Link
Аноним Аноним
  • 25-10-2016
120 times 3 is 360. she now owns 360 books!! hope this helps
Answer Link

Otras preguntas

Complète les phrases avec la forme correcte des adjectifs donnés à la fin!
HELPPP PLEASEE!!!!!!!!!!!!!!!!!!!!!!!! Transcribe the following DNA strand: AAATACCCCGTAATGGCATAGGTCTGCACT
Gasoline costs 1.74 euro per liter in France. What is the price in dollars per gallon?
I need some help. I don’t know how to do this Find the value of x
How did the ruling of Cohens v. V irginia influence the power of the Supreme Court? It allowed the Supreme Court to hear state cases based on Constitutional iss
write down the next 2 numbers in the following sequence: 35, 25, 16, 8 ​
PLEASE HELP ME!!!! 20 POINTS Why do primates have a longer childhood than other mammals?
Why do people think jojo is mid. Its so good
Write a essay abt poems
PLS HELPFODKEME rmwmemre