bsnanamamsm bsnanamamsm
  • 21-12-2020
  • Mathematics
contestada


If you’re correct I’ll give u brainlist

If youre correct Ill give u brainlist class=
Relax

Respuesta :

irjt
irjt irjt
  • 21-12-2020

Answer:

It's SAS, the congruent angle is between both sides.

Answer Link

Otras preguntas

Marley has read 112.5 pages of a book. By the end of today, she plans to have read at least a total of 360 pages. If she reads 45 pages per hour, what is the mi
PLEASSE HELP ME WITH THIS
Consider the following sequence of genomic DNA which is a template strand containing the beginning of the open reading frame for a gene. 3'TAAACTGTACAGGGCCATAAC
can you please help me please
Jesse travels 3.0 meters east and then turns and travels 4.0 meters north. What distance did Jesse travel?
What do they mean when they say, "Society pays for the end results of alcohol abuse"? Do they mean that the person who consumed it pays the consequences or lite
I need help please what are some negative effects of stress on an individual? For this discussion, I would like everyone to explain how stress affects an indivi
A major cause for gender inequality is believed to be (Points : 1) economic division of labor by gender. political leadership. women’
can organisms naturally repair a mutation?
Find the mean of these values 6,4,8,2,5