koepplm koepplm

25-10-2020
Mathematics

contestada

A ladder rises 20 feet for every horizontal change of 4 feet. What is the slope of the ladder?

Relax

Respuesta :

sarmentn sarmentn

25-10-2020

Answer:

20/4

Step-by-step explanation:

rise/run so rise 20 over 4.

Answer Link

Otras preguntas

How are vibrations different between bigger sizes rubber bands and smaller sized rubber bands?

Who is Christina LeConte

Who is Barbare Sonek?

Consider the following sequence of genomic DNA which is a template strand containing the beginning of the open reading frame for a gene. 3'TAAACTGTACAGGGCCATAAC

which process do scientists think provided earth with an oxygen- rich atmosphere

Look At The Picture. Thats The Question I Need Answered ASAP

What makes for good scientific data

A cubic centimeter holds 1 milliliter of liquid. How many liters of water to the nearest tenth are required to fill a fish tank that is 24 centimeters high, 28

Find the mean of these values 6,4,8,2,5

What educational level, age and econimic status of the audience do I reach when talking bout geriatric offices