helenirby1964 helenirby1964

22-05-2020
Chemistry

contestada

4. Translate the following RNA sequence into a protein chain.
AUGGUUACCAGUCGCUUAUAA
Please

Relax

Respuesta :

FortniteforLifeooof FortniteforLifeooof

22-05-2020

Answer:

AUUUAAAHAHYAGHY

Explanation:

Answer Link

Otras preguntas

Hoy comienzan mis vacaciones por el sur de Chile. Voy a ir a cinco ciudades diferentesTemuco, Osorno, Villarrica, Pucón y Chiloé. Hice reservaciones en el hotel

two cubes each measure 7 units on each side. write and espression using exponents to represent the total volume of the cubes.

Read the passage. I left the port city early in the morning. The boat was loaded with wood, spices, and perfumes from lands across the sea. Raising our sails, w

I NEED THIS ASAP!! Please help!!! :3 When Alexis bought groceries, she received a discount of 25%. Write an expression to represent the sale price of the groce

Jenny is a software salesperson. Her base salary is $ 1500 and she makes $50 more for every copy of English is Fun she sells. Her total pay, P (in dollars), af

how to do this question plz

1.A cook has 2 3/4 pounds of ground beef.How many quarter-pound burgers can he make?2.A child needs to take 1/6 tablespoons of medicine per day in 4 equal doses

The odds against a chess-master beating a computer are 11:5. What is the probability the at the chessmaster will win a match against the chessmaster?

Sam loaned Sofia $5000 at an interest rate of 6%. She repaid him $5750 to cover the principal and interest. How long did she borrow the money?

An ant crawls at a speed of 3.5 dm per second. What is the ant's speed in miles per hour? (1 mile is 5280 ft) ( i in = 2.54 cm)