megan2442
megan2442 megan2442
  • 22-10-2019
  • Chemistry
contestada

what is the [OH-],[H3O] and PH for the following

a) 6.5×10-¹ M NaOH
b) 4.7×10-² M KOH
c) 1.2×10-² M LiOH
d) 8.8×10-³ M NaOH​

Relax

Respuesta :

cristisp93
cristisp93 cristisp93
  • 02-11-2019

The values for hydroxide ions, hydronium ions and pH are found in the attached picture.

Explanation:

See the attached picture.

Learn more about:

pH

brainly.com/question/1525823

#learnwithBrainly

Ver imagen cristisp93
Answer Link

Otras preguntas

how to solve these questions?
Consider the following sequence of genomic DNA which is a template strand containing the beginning of the open reading frame for a gene. 3'TAAACTGTACAGGGCCATAAC
Can someone help me with this problem... #20
Are individuals empowered and do they understand their human rights or when their rights / the rights of others are being violated. Provide FIVE reasons for you
8 1/4 in simplest form
What is the power output of an electric motor that lifts a 2.0 kilogram block 15 meters vertically in 6.0 seconds
Perpendicular lines intersect to form __________________ angles
If 1+4=5 and 2+5=12 what does 8+11=
dont knwo the answers for question 4,5,6
George tells you that when variables are in the denominator, the equation four over five plus three over x equals one over two becomes unsolvable. George explai