aryanan22
aryanan22 aryanan22
  • 23-09-2019
  • Mathematics
contestada

G= 6x , for x

What is the answer

Relax

Respuesta :

pranklord64 pranklord64
  • 23-09-2019

Answer: The answer is x=G/6

Answer Link
1841083735kylin
1841083735kylin 1841083735kylin
  • 23-09-2019

Answer:

x=G/6

If G is a constant, put G in the top equation

Answer Link

Otras preguntas

john bought a used truck for $4,500 he made an agreement with the dealer to put $1,500 down and mae payments of $350 for the next 10 months the extra cost paid
Write a recursive function for this sequence 8,12,18,27..
The height in inches of three boys is 54.0 48.5 46.0 respectively the height of the 4th boy is denoted by h inches the average height a of the 4 boys can be exp
Which transition word would a writer use to indicate a conclusion to a text? A: finally B: despite C: although D: however
Consider the following sequence of genomic DNA which is a template strand containing the beginning of the open reading frame for a gene. 3'TAAACTGTACAGGGCCATAAC
Use these words in a sentence proton neutron and isotope
what mass of iron 3 chloride contain 2.35 x 10 to the 23rd chloride ions
can you please help me please
what is the law of conservation of mass?
Use these words in a sentence proton neutron and isotope