BVAZQUEZ8081 BVAZQUEZ8081
  • 25-01-2024
  • Engineering
contestada

The cAMP-CAP binding site is between operators O1 and O3. When cAMP-CAP is bound, it facilitates binding of the repressor. Under what conditions would this occur?
a) In the presence of glucose and lactose
b) In the absence of glucose and lactose
c) In the presence of glucose only
d) In the presence of lactose only

Relax

Respuesta :

Otras preguntas

What does it mean to cross-reference information
3.Original DNA sequence: 3' TACCGCTTACGTCTGATCGCT 5' Mutated DNA sequence: 3' TACCGCTTATTATTACGTGCTGCTATCGCT 5' Type of mutation (3pts): Amino acid ( 3pts):
How do we measure the height of mountain? Grade 6
Kenya uses mental math to find the sum of 235 and 23. She uses 235, 20, and one other number. What is the missing number? 3 5 35 58
I wouldn't even blink if I (will see) this whole world burning. * had seen saw am seeing see
Why the body needs more water after exercising/performing rigorous activity
Help me with my Science, Part 1 and 2 please this has to be done by tomorrow
Similarities of manipulative and interactive media brainly.
A tow truck exerts a force of 3000 n on a car, which then accelerates at 2 m/s/s. What is the mass of the car?.
i need help please!!!!