riveraleslie9458 riveraleslie9458
  • 23-01-2024
  • Mathematics
contestada

What is the number halfway between $1$ and $5 3/5 on the number line?
A) $2.5$
B) $3.0$
C) $3.8$
D) $4.8$

Relax

Respuesta :

Otras preguntas

The founding of the united states has traditional roots in judeo-christian teachings as well as philosophies developed primarily during the —.
What is the remainder when x2−4x+2 is divided by x+3?
Alcohol and Its EffectsA.Check the facts in the graph below and answer the questions. The graph is based on the effects of alcohol on a 150-pound adult male who
Given f(x) = 3x^2 + 7x and g(x) = 2x^2 - X-1, find (f+g) (x)
Cuando estoy de vacaciones prefiero usar ______________ porque es de bajo costo y me gusta hacer ejercicio mientras viajo. A. el carro B. el avión C. la bici
HELPPP PLEASEE!!!!!!!!!!!!!!!!!!!!!!!! Transcribe the following DNA strand: AAATACCCCGTAATGGCATAGGTCTGCACT
In the sound of music, how many children are in the von trapp family?.
the jeffson family has 5 whole pizza to be shared among 7 people each person in the jeffson family will receive pizza
find the equation from the model -2x+6=2
Choose if the following lines are Hip Hop lyrics or Harlem Renaissance poetry: “People, people we are the same / No we're not the same / Cause we don't know the