bmaddy6588 bmaddy6588
  • 25-05-2023
  • Business
contestada

The Federal Budget 2022-23 has halved the excise tax for the next six months on petroleum from 44 cents per litre to reduce the cost of living. Using an appropriate diagram, explain the effect of the cut in excise tax on output, employment, and price level

Relax

Respuesta :

Otras preguntas

I actually need help tho plssss
x²-x-6=0. find the values of x​
write a related function for -6x+8x-5=3
Use the following DNA sequences and transcribe each into mRNA. ATACCGATACGGACTTCATCGGATACGCGCCGGATCCAGTCACTA(I Have 3,000 points and will give brainliest and I
Moving to another question will save this response. Question 5 In John Keats's "Ode on a Grecian Umn," what does the speaker predict will happen to the um? It w
the presidential system of government is characterized by the ______
what room is impossible to enter ?? riddle​
Which expression is equivalent to sum of quantity negative three and one third times n plus one sixth end quantity plus quantity one and three sixths times n mi
The marginal cost of a good is given by
Aditi bought 20 apples at Rs 25 each and sold them at Rs 32 each. What is her total profit?​