FreshLuck937 FreshLuck937

24-11-2022
Physics

contestada

A man wishes to pull a crate 15m across a rough floor by exerting a force of 100 n. The coefficient of kinetic friction is 0. 25. For the man to do the least work, the angle between the force and the horizontal should be:.

Relax

Respuesta :

Otras preguntas

Can someone help me please?? It’s due on thursday ❤️ (rotate picture if u can)

0 다. II 2 3 5 101 1 Using the alleles A and a, what is the genotype of individual a) 11-6 b) 1-4 11-7

3.Original DNA sequence: 3' TACCGCTTACGTCTGATCGCT 5' Mutated DNA sequence: 3' TACCGCTTATTATTACGTGCTGCTATCGCT 5' Type of mutation (3pts): Amino acid ( 3pts):

16,40 and 56 LCMSolve this problem

A hot air balloon holds 1,592 cubic meters of helium. The density of helium is 0. 1785 kilograms per cubic meter. How many kilograms of helium does the balloon

An account earns 8.4% interest compounded monthly. If 12,000 is invested in the account initially, how much interest is earned in this account over a 25 year pe

2.5 x 10^3 times what number is equal to 5 x 10^6?

Describe four characteristics of S-block elements

help help help help

Ron wants to make money painting portraits of people at the local mall. The mall charges Ron $22.00 a day for Ron to set up his materials to sell his portraits.